SNP Chip Consortium

Public raw SNP data compiled for a Pig SNP Chip

Raw data source: NCBI/dbSNP, Martien Groenen, Max Rothschild, Miguel Perez, Kwan-suk Kim, Gary Rohrer groups
Scores: [ Quality Score / Info. Score ]
(a) Sequence quality score: Range: 25-125. An indicator of the sequence quality in terms of (1) the number of variable nucleiotide in the flanking sequences (higher number of variable NT negatively contributes to the score); (2) the length of the flanking sequences (if shorter than 60 bp, negatively contributes to the score).
(b) Information score: Range: 10-70. The presence of (1) minor allele frquency (MAF), (2) chromosome location, (3) annotation, each add 20 to the total "info score".
Consortium contact: Max Rothschild, Martien Groenen
Technical Contact: Zhiliang Hu (about the compilation of this data set).
Date: July 31, 2008

Records 17701 - 17704:

Custom Name	Position	Length	Taxonomy	Flanking Sequence - Left	Alleles	Flanking Sequence - Right	Chromosome	Annotation	Reference	Source	Scores (seq.qual/info)
BGISUSV0000213358	177215	61	9823	GAAGACCCCTCCCACCCTGAGGCCTTGGGT	T/C	ACCAAGGCGTTATACTCCTTCACAGCCTGC	9	C11orf67\|Change amino acid:s	SANGERun\|bE194G22	Miguel Perez (PIGGIS)	60 / 50
BGISUSV0000213359	68249	61	9823	CAGGGAGGTCCCCGAGGAGTACGAGGATGG	A/C	GGCTTCATGGAGGAGGTGCGCCGGGAGCTG	2	DKK3\|Change amino acid:s	SANGERun\|bE316F6	Miguel Perez (PIGGIS)	60 / 50
BGISUSV0000213361	161669	45	9823	ACTTCAGTCAGGAGGGATCGTAATGACTTT	T/G	GGGAAGGTATTAAA	X	WDR44\|Change amino acid:a	SANGERun\|bE434N2	Miguel Perez (PIGGIS)	44 / 50
BGISUSV0000213353	126928	43	9823	TTCACTGTCGACAGATGACCCGATGCAATT	T/C	CACTTCACCAAG	4	AMPD1\|Change amino acid:s	SANGERun\|bE266G7	Miguel Perez (PIGGIS)	42 / 50

4 Rows queried.

Go to records:
1-100, 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-1000, 1001-1100, 1101-1200, 1201-1300, 1301-1400, 1401-1500, 1501-1600, 1601-1700, 1701-1800, 1801-1900, 1901-2000, 2001-2100, 2101-2200, 2201-2300, 2301-2400, 2401-2500, 2501-2600, 2601-2700, 2701-2800, 2801-2900, 2901-3000, 3001-3100, 3101-3200, 3201-3300, 3301-3400, 3401-3500, 3501-3600, 3601-3700, 3701-3800, 3801-3900, 3901-4000, 4001-4100, 4101-4200, 4201-4300, 4301-4400, 4401-4500, 4501-4600, 4601-4700, 4701-4800, 4801-4900, 4901-5000, 5001-5100, 5101-5200, 5201-5300, 5301-5400, 5401-5500, 5501-5600, 5601-5700, 5701-5800, 5801-5900, 5901-6000, 6001-6100, 6101-6200, 6201-6300, 6301-6400, 6401-6500, 6501-6600, 6601-6700, 6701-6800, 6801-6900, 6901-7000, 7001-7100, 7101-7200, 7201-7300, 7301-7400, 7401-7500, 7501-7600, 7601-7700, 7701-7800, 7801-7900, 7901-8000, 8001-8100, 8101-8200, 8201-8300, 8301-8400, 8401-8500, 8501-8600, 8601-8700, 8701-8800, 8801-8900, 8901-9000, 9001-9100, 9101-9200, 9201-9300, 9301-9400, 9401-9500, 9501-9600, 9601-9700, 9701-9800, 9801-9900, 9901-10000, 10001-10100, 10101-10200, 10201-10300, 10301-10400, 10401-10500, 10501-10600, 10601-10700, 10701-10800, 10801-10900, 10901-11000, 11001-11100, 11101-11200, 11201-11300, 11301-11400, 11401-11500, 11501-11600, 11601-11700, 11701-11800, 11801-11900, 11901-12000, 12001-12100, 12101-12200, 12201-12300, 12301-12400, 12401-12500, 12501-12600, 12601-12700, 12701-12800, 12801-12900, 12901-13000, 13001-13100, 13101-13200, 13201-13300, 13301-13400, 13401-13500, 13501-13600, 13601-13700, 13701-13800, 13801-13900, 13901-14000, 14001-14100, 14101-14200, 14201-14300, 14301-14400, 14401-14500, 14501-14600, 14601-14700, 14701-14800, 14801-14900, 14901-15000, 15001-15100, 15101-15200, 15201-15300, 15301-15400, 15401-15500, 15501-15600, 15601-15700, 15701-15800, 15801-15900, 15901-16000, 16001-16100, 16101-16200, 16201-16300, 16301-16400, 16401-16500, 16501-16600, 16601-16700, 16701-16800, 16801-16900, 16901-17000, 17001-17100, 17101-17200, 17201-17300, 17301-17400, 17401-17500, 17501-17600, 17601-17700, 17701-17704